Follow Us!
* Call or Write Us Today
Total Health Fx / Joe & Kathi Fox
23830 Tonnet Circle
Romoland CA 92585
Toll-free 800-557-6821 / Local 951-677-8822
Cell 951-255-6317
* Send Us an Email: Contact@TotalHealthFx.com
*Subscribe to Our Newsletter >>
Skype Call/Video
Total Health Fx Social Media
- View and Register for Instant Updates !
Category Archives: Foods and Goods
Healthy Vegetarian Meals for the Holidays
Healthy Vegetarian Meals for the Holidays
Healthy Vegetarian Meals for the Holidays
A CookBook of Gourmet Recipes
by Kathi Fox, Total Health Naturopath
“When people hear that we are vegetarian, inevitably someone asks,”What do you have for Thanksgiving?” The answer has always been the same: ”Everything except the turkey.” Being vegetarian for many years, the holiday fare has evolved from making the traditional dishes, to incorporating new ones. These are the recipes that I have perfected and that my family loves. You can make and serve any of these and your guests will not even notice what is not there. It is easy to elimainate animal products from your diet and still have special meals to celebrate with at holiday times.” ~ from the Introduction, Healthy Vegetarian Meals for the Holidays, by Kathi Fox
” Testing the gourmet recipes in the creation of Healthy Vegetarian Meals for the Holidays has made me “oh so happy! These are the most fun of all of Kathi’s healthy recipes. You’ll find many healthy meals, savory side-dishes, and awesome healthy desserts in one of the best vegetarian cookbooks!” ~ Joe Fox, the author’s husband, Natural Health Practitioner, and vegetarian for many years
[wp_cart:Healthy Vegetarian Meals for the Holidays/CookBook (shipping includes tax/handling):price:7.50:shipping:4.00:end]
Features of Healthy Vegetarian Meals for the Holidays
- over 100 pages
- over 60 unique recipes
- indexed by meal course categories such as appetizers, salads, dressings, entrees, side dishes, healthy desserts, etc
- indexed by nutrition status categories such as lacto-vegetarian, vegan, gourmet, health-building, purifying, gluten-free, dairy-free, low salt, sugar alternatives, etc
- reasonably priced , only $7.50 + applicable tax and nominal shipping/handling
[wp_cart:Healthy Vegetarian Meals for the Holidays/CookBook (shipping includes tax/handling):price:7.50:shipping:4.00:end]
“Healthy Vegetarian Meals for the Holidays” Available Elsewhere Online
- Amazon.com Printed Book
- Kindle E-Books Digital E-Book
- CreateSpace E-Store Printed Book
Posted in BLOG FX, Foods and Goods, Information & Resources, Nutrition and Healthy Lifestyle
Tagged dairy-free, gluten-free, gourmet, gourmet recipes, health-building, healthy meals, healthy recipes, lacto-vegetarian, low salt, purifying, sugar alternatives, vegan, vegetarian cookbooks, vegetarian meals
Leave a comment
Genetically Modified Food
Genetically Modified Food: Effects on Our Health Safety and Environment
Genetically modified food also known as genetically modified organisms is a big issue, especially in light of their effects on our health safety and our environment. Politics aside, here we are taking a look at genetically modified foods and the consequences on our health and the environment. We don’t know for certain which of our foods have been modified . We don’t understand how they have been modified… have our plant-based foods been genetically engineered with genetic material from humans, animals, fish, birds, insects, or amphibians? I certainly hope not, not in this plant-based body!
“Genetic Engineering is often justified as a human technology, one that feeds more people with better food. Nothing could be further from the truth. With very few exceptions, the whole point of genetic engineering is to increase sales of chemicals and bio-engineered products to dependent farmers.” David Ehrenfield: Professor of Biology, Rutgers University
The Institute for Responsible Technology asks, “Is the FDA protecting us? No. The Food and Drug Administration policy on genetically modified organisms (GMOs), released in 1992, falsely claims that the agency had no information showing that GM foods are substantially different… FDA scientists repeatedly warned of possible allergies, toxins, new diseases, and nutritional problems; they urged long-term safety studies. But the FDA official in charge of policy was Michael Taylor, Monsanto’s former attorney, later their vice president, and now the US Food Safety Czar. The FDA ignored their scientists, and doesn’t require a single safety test. Instead, companies such as Monsanto, which have been found guilty of hiding toxic effects of their other products, get to decide if their GMOs are safe for us to eat. And the superficial studies they do conduct are widely criticized as rigged to avoid finding problems. The laboratory techniques are imprecise and bear no resemblance to natural breeding. The technology is based on outdated scientific assumptions and can lead to massive collateral damage in the plant. The DNA of GMOs, for example, can have hundreds or thousands of mutations, and the activity of up to 5% of their natural genes can be significantly changed. Even the inserted gene can be damaged or rearranged, creating proteins that trigger allergies or promote disease.
GM foods on the market
The Institute for Responsible Technology notes the six major GMO crops are soy, corn, canola, cotton, sugar beets, and alfalfa. Each has added bacterial genes, allowing plants to survive an otherwise deadly dose of weed killer such as Roundup. Farmers use considerably more herbicide on these crops, causing higher herbicide residues in our food. The second most popular trait is a built-in pesticide, found in GM corn and cotton. An inserted gene from soil bacteria called Bt (Bacillus thuringiensis) secretes the insect-killing Bt-toxin in every cell. The other GM crops are Hawaiian papaya and a small amount of zucchini and yellow crookneck squash, which are engineered to resist a plant virus.
The Institute for Responsible Technology lists these concerns:
- GMOs: unnatural, imprecise, prone to side-effects
- Growing Evidence of Harm from GMOs
- GMOs and allergic reactions
- Bt corn and cotton linked to allergies
- GMOs may make you allergic to non-GM foods
- GMOs, reproductive problems, and infant mortality
- Bt crops linked to sterility, disease, and death
- Functioning GM genes remain inside you
The American Academy of Environmental Medicine (AAEM) urges physicians to advise all patients to avoid genetically modified (GM) food. They state, “Several animal studies indicate serious health risks associated with GM food.” These include:
- Infertility
- Immune problems
- Accelerated aging
- Faulty insulin regulation
- Changes in major organs and the gastrointestinal system.
FED UP! Genetic Engineering, Industrial Agriculture & Sustainable Alternatives
Deborah B. Whitman in CSA Discovery Guides‘
Genetically Modified Foods: Harmful or Helpful?
Questions:
- What are some of the advantages of GM foods?
- What are genetically-modified foods?
- How prevalent are GM crops?
- What plants are involved?
- What are some of the criticisms against GM foods?
- How are GM foods regulated and what is the government’s role in this
- process?
- How are GM foods labeled?
Concerns:
- Pest resistance
- Herbicide tolerance
- Disease resistance
- Cold tolerance
- Drought tolerance/salinity tolerance
- Malnutrition
- Pharmaceuticals
- Unintended harm to other organisms
- Reduced effectiveness of pesticides
- Gene transfer to non-target species
- Human health risks
- Allergenicity
- Unknown effects on human health
From 50 Harmful Effects of Genetically Modified Foods :
(An outline extracted from the full article)
HEALTH
Deaths and Near-Deaths
1. Recorded Deaths from GM
2. Near-deaths and Food Allergy Reactions
CORN- Two research studies independently show evidence of allergenic reactions to GM Bt corn,
- Farm workers exposed to genetically-modified Bt sprays exhibited extensive allergic reactions.
POTATOES - A study showed genetically-modified potatoes expressing cod genes were allergenic.
PEAS - A decade-long study of GM peas was abandoned when it was discovered that they caused allergic lung damage in mice.
SOY - In March 1999, researchers at the York Laboratory discovered that reactions to soy had skyrocketed by 50% over the year before, which corresponded with the introduction of genetically-modified soy from the US. It was the first time in 17 years that soy was tested in the lab among the top ten allergenic foods.
Cancer and Degenerative Diseases
3. Direct Cancer and Degenerative Disease Links
4. Indirect, Non-traceable Effects on Cancer Rates: combining chemical food additives into chemical cocktails caused many times more toxic effects
Viral and Bacterial Illness
5. Superviruses: Viruses can mix with genes of other viruses and retroviruses
6. Antibiotic Threat Via Milk
7. Antibiotic Threat Via Plants
8. Resurgence of Infectious Diseases
Allergies
9. Increased Food Allergies: The loss of biodiversity in our food supply has grown in parallel with the increase in food allergies. Each new food item produced contains many new potentially allergenic proteins.
10. Birth Defects and Shorter Life Spans
11. Interior Toxins: “Pesticidal foods” have genes that produce a toxic pesticide inside the food’s cells.
12. Lowered Nutrition
General
13. No Regulated Health Safety Testing
14. Unnatural Foods: “a profound difference between the types of expected effects from traditional breeding and genetic engineering.” ”Pleiotropic effects occur in genetically engineered plants.There is “something tangibly different about the food that is material with respect to the consequences which may result from the use of the food.”
15. Radical Change in Diet: Ten companies now own about 40% of all US seed production and sales. Also 60% of all hard cheeses in the US are processed with a GM enzyme. The current result is that approximately two-thirds of all processed foods in the US already contain GM ingredients - and this is projected to rise to 90% within four years according to industry claims. In short, the human diet, from almost every front, is being radically changed – with little or no knowledge of the long-term health or environmental impacts.
ENVIRONMENT
“Genetic Engineering is often justified as a human technology, one that feeds more people with better food. Nothing could be further from the truth. With very few exceptions, the whole point of genetic engineering is to increase sales of chemicals and bio-engineered products to dependent farmers.”
David Ehrenfield: Professor of Biology, Rutgers University
General Soil Impact
16. Toxicity to Soil
17. Soil Sterility and Pollution
Seeds
18. Extinction of Seed Varieties
Plants
19. Superweeds: It has been shown that genetically modified Bt endotoxin remains in the soil at least 18 months and can be transported to wild plants creating superweeds potentially disturbing the balance of nature.
20. Plant Invasions
Trees
21. Destruction of Forest Life: GM trees or “supertrees“ are being developed which can be sprayed from the air to kill literally all of surrounding life, except the GM trees. There is an attempt underway to transform international forestry by introducing multiple species of such trees. The trees themselves are often sterile and flowerless.
22. Terminator Trees: These super deadly trees are non-flowering, herbicide-resistant and with leaves exuding toxic chemicals to kill caterpillars and other surrounding insects – destroying the wholesale ecology of forest life.
23. Superpests:
24. Animal Bio-invasions: Fish and marine life are threatened by accidental release of GM fish threatening local fish supplies.
25. Killing Beneficial Insects: Studies have shown that GM products can kill beneficial insects
26. Poisonous to Mammals: In a study with GM potatoes, spliced with DNA from the snowdrop plant and a viral promoter (CaMV), the resulting plant was poisonous to mammals (rats) – damaging vital organs, the stomach lining and immune system.
27. Animal Abuse “supercrippling”
28. Support of Animal Factory Farming: Rather than using the best of scientific minds to end animal factory farming - rapid efforts are underway to develop gene-modified animals that better thrive in disease-promoting conditions of animal factory farms.
Genetic Uncertainties
29. Genetic Pollution: Carrying GM pollen by wind, rain, birds, bees, insects, fungus, bacteria – the entire chain of life becomes involved. Once released, unlike chemical pollution, there is no cleanup or recall possible.
30. Disturbance of Nature’s Boundaries: Genetic engineers argue that their creations are no different than crossbreeding. However, natural boundaries are violated – crossing animals with plants, strawberries with fish, grains, nuts, seeds, and legumes with bacteria, viruses, and fungi; or like human genes with swine.
31. Unpredictable Consequences of a Gunshot Approach“wedging foreign genetic material in an essentially random manner…causes some degree of disruption…It is impossible to predict what specific problems could result.”
IMPACT ON FARMING
Small Farm Livelihood and Survival
32. Decline and Destruction of Self-Sufficient Family Farms
33. General Economic Harm to Small Family Farms
Organic Farming
34. Losing Purity: At the present rate of proliferation of GM foods, within 50-100 years, the majority of organic foods may no longer be organic.
35. Mixing of GM and non-GMO crops
36. Losing Natural Pesticides
Control and Dependency
37. Terminator Technology: Plants are being genetically produced with no annual replenishing of perennial seeds so farmers will become wholly dependent on the seed provider.
38. Traitor Technology: Traitor technologies control the stages or life cycles of plants – when a plant will leaf, flower, and bear fruit. This forces the farmer to use certain triggering chemicals if he is to yield a harvest
Farm Production
39. Less Diversity, Quality, Quantity and Profit: One of the most misleading hopes raised by GM technology firms is that they will solve the world’s hunger.
40. Fragility of Future Agriculture: With loss of biological diversity there inevitably develops a fragility of agriculture.
41. Lower Yields and More Pesticides Used With GM Seeds
42. Monopolization of Food Production: The rapid and radical change in the human diet was made possible by quick mergers and acquisitions that moved to control segments of the US farming industry.
43. Impact on Long -Term Food Supply: If food production is monopolized,the future of that supply becomes dependent on the decisions of a few companies and the viability of their seed stocks.
ECONOMIC, POLITICAL AND SOCIAL THREATS
46. Health/Environmental/Socio-Political Reasons: The lack of labeling of genetically modified food violates and harms your right to know what is in our foods – given the list of health, environmental, and socio-political reasons to avoid GM ingredients. Even if GM foods were 100% safe, the consumer has a right to know such ingredients – due to their many potential harms.
47. For Religious Dietary Reasons: Previously if someone wanted to avoid foods not permitted by certain religions, the process was simple. With transgenic alterations, every food is suspect – and the religious and health-conscious consumer has no way of knowing without a mandated label. The lack of labeling makes it impossible for religious people to observe dietary customs.
Total Health Food Co-op Price Comparisons
Total Health Food Co-op Price Comparisons
Here you will find prices comparing several food items available through the Total Health Food Co-op’s catalog from United Natural Foods, Inc. (UNFI) and several local health food and grocery stores. The food items selected are healthy foods, wholesale foods and discount foods. In summary, recent Total Health Food Co-op research shows the best prices more often and with more availability of all products than comparable stores. Download the Total Health Food Co-op Price Comparisons and view in Excel. Also see Total Health Food Co-op instructions, ordering and delivery dates. and more about Total Health Fx
Breast Cancer Survival Rates Improve With Cruciferous Vegetable Consumption
Breast Cancer Survival May Improve With Vegetable Consumption
April 4, 2012
In another boon for broccoli, researchers have found that eating the green vegetable may improve outcomes after a breast cancer diagnosis. A new study points to the positive role that all cruciferous veggies — like cauliflower, brussels sprouts, kale and cabbage — can play in improving survival and recurrence rates associated with breast cancer.
In the study, presented Tuesday at the American Association for Cancer Research’s annual meeting, researchers looked at data from more than 4,800 breast cancer survivors in China who had been diagnosed with breast cancer between 2002 and 2006. The women’s cancers ranged from stage 1 to stage 4.
Overall, researchers with the Vanderbilt Epidemiology Center and Shanghai Centers for Disease Control and Prevention found that higher consumption of cruciferous vegetables in the years following diagnosis was tied to better outcomes. Women who ate the most reduced by 62 percent their risk of both overall mortality and breast cancer-specific mortality, as compared to women who consumed the least. Those who consumed the most vegetables also reduced by 35 percent the risk of their breast cancer coming back. Researchers compared relative quantities of the vegetables in women’s diets and have not determined at what quantities the beneficial effects are derived.
“Cruciferous vegetables, such as cauliflower, cabbage, bok choy, turnips and broccoli, contain high amounts of glucosinolates, which are hydrolyzed to bioactive compounds including isothiocyanates (ITCs) and indoles,” said Sarah Nechuta, a research fellow in Vanderbilt University’s epidemiology center and a researcher on the new study, who explained that she and her fellow researchers attempted to control for other factors that might influence women’s outcomes, including demographics, exercise and additional dietary behaviors.
“These bioactive compounds have many anti-cancer properties that may influence cancer development, progression and survival,” Nechuta added.
This is not the first time that the cabbage family has been tied to decreased breast cancer risk.
A 2008 study in The American Journal of Clinical Nutrition (see below) which also focused on Chinese women, linked consumption of cabbage and white turnips to lower breast cancer risk.
“An association has also been established with colon cancer and prostate cancer,” explained Emily Ho, an associate professor in nutrition and exercise sciences at Oregon State University. “There is pretty strong evidence from studies that compounds found in cruciferous vegetables may have cancer-fighting properties.”
The new study is, however, among the first to look at the role that cruciferous vegetables can play aftera cancer diagnosis.
But Ho cautioned that many questions about the connection between vegetables and cancer risk remain.
“There are still a lot of unanswered questions about what, exactly, is in [cruciferous vegetables] that is protective,” she said. Researchers do not understand exactly what the underlying mechanisms are and what impact these vegetables may have at the tissue level, she said. Furthermore, research has not yet made it clear whether supplements could have the same potential effect as vegetables themselves seem to have.
Nechuta also cautioned that it should not necessarily be assumed that similar results would be achieved in the United States, where the types of cruciferous vegetables women eat may be different than those in China.
“Commonly consumed cruciferous vegetables in China include turnips, Chinese cabbage [or] bok coy and greens, while broccoli and brussels sprouts are the more commonly consumed cruciferous vegetables in the United States and other Western countries,” Nechuta said in a statement. In an email to The Huffington Post, she said that future studies with direct measurements of various bioactive compounds are needed in order to understand the possible link between cruciferous vegetables and breast cancer intake.
In the meantime, Ho said people would do well to follow fruit and vegetable consumption guidelines.The American Cancer Society, for example, recommends that individuals consume at least two and a half cups of fruits and vegetables per day to lower cancer risk, pointing out that those foods with the most color — which are dark green, red, yellow and orange — provide the most nutrients.
“If you try and include cruciferous vegetables as some of those servings,” Ho said. “It probably won’t hurt and it certainly might help.”
American Journal of Clinical Nutrition, Vol. 87, No. 3, 753-760, March 2008
© 2008 American Society for Nutrition
ORIGINAL RESEARCH COMMUNICATION |
Cruciferous vegetables, the GSTP1 Ile105Val genetic polymorphism, and breast cancer risk
Sang-Ah Lee, Jay H Fowke, Wei Lu, Chuangzhong Ye, Ying Zheng, Qiuyin Cai, Kai Gu, Yu-Tang Gao, Xiao-ou Shu and Wei Zheng
1 From the Vanderbilt Epidemiology Center, Vanderbilt University Medical Center, Nashville, TN (S-AL, JHF, CY, QC, XS, and WZ); the Shanghai Center for Disease Control and Prevention, Shanghai, China (WL, YZ, and KG); and the Department of Epidemiology, Shanghai Cancer Institute, Shanghai, China (Y-TG)
Supported by RO1 CA 64277 and RO1 CA 90899 from the National Cancer Institute.
Reprints not available. Address correspondence to JH Fowke, Institute for Medicine & Public Health, Vanderbilt University Medical Center, 6th floor, Suite 600, 2525 West End Avenue, Nashville, TN 37203-1738. E-mail: jay.fowke@vanderbilt.edu.
ABSTRACT
Background: Cruciferous vegetables are the primary source of isothiocyanates and other glucosinolate derivatives that are known to induce phase II detoxifying enzymes, including glutathione S-transferases (GSTs).
Objective: We investigated the independent and combined effects of cruciferous vegetable intake and the GSTP1 Ile105Val genetic polymorphism on breast cancer risk.
Design: Analyses included 3035 cases and 3037 population controls who were participating in the Shanghai Breast Cancer Study and for whom diet and genetic data were complete (87% of cases and 85% of controls).
Results: With the use of multivariate logistic regression, the GSTP1 Val/Valgenotype was significantly associated with greater breast cancer risk (OR = 1.50; 95% CI: 1.12, 1.99). The association was significantly greater in premenopausal women (OR = 1.69; 95% CI: 1.17, 2.43) than in postmenopausal women (OR = 1.20; 95% CI: 0.74, 1.92). Total cruciferous vegetable intake was not significantly associated with breast cancer risk, although subjects reporting greater turnip (Pfor trend < 0.001) and Chinese cabbage (P for trend = 0.049) intakes had a significantly lower postmenopausal breast cancer risk. Women with the GSTP1 Val/Val genotype and low cruciferous vegetable intake had a breast cancer risk 1.74-fold (95% CI: 1.13, 2.67) that of women with the Ile/Ile or Ile/Val genotype. This effect of low cruciferous vegetable intake and the Val/Val genotype was seen predominantly among premenopausal women (OR = 2.08; 95% CI = 1.20, 3.59).
Conclusions: Cruciferous vegetable intake consistent with high isothiocyanate exposure may reduce breast cancer risk. Cruciferous vegetable intake also may ameliorate the effects of the GSTP1 genotype.
Key Words: Cruciferous vegetables • GSTP1 genetic polymorphism • breast cancer risk • gene-diet combined effect
INTRODUCTION
Cruciferous vegetable are an especially rich source of glucosinolates, which may be converted by plant myrosinase and the gastrointestinal microflora to isothiocyanates, indole-3-carbinol, and other compounds believed to have anticancer properties. These agents may affect carcinogenesis through several mechanisms, including the induction of apoptosis and a shift in estrogen metabolism to favor metabolites with lower estrogenic activity (1, 2). In addition, isothiocyanates induce multiple phase II conjugating enzyme systems (3, 4), including glutathione S-transferases (GSTs), through nuclear transcription factor–E2–related factor 2–enhanced transcription (5, 6). The overall effects of cruciferous vegetable intake appear to be a reduction in systemic oxidative stress (7) and a suppression of mutagenic and carcinogenic activity (8). Indeed, cruciferous vegetable intake has been inversely associated with the risk of lung, stomach, colorectal, bladder, and other cancers (9, 10). However, despite strong biologic plausibility, the relation between cruciferous vegetable intake and breast cancer risk is unclear. Several studies found no association between total or cruciferous vegetable intake and breast cancer risk (10–13). In contrast, case-control studies from Sweden (14), the United States (in premenopausal women) (15), and Shanghai (16) reported a reduction in breast cancer risk associated with cruciferous vegetable intake.
The capacity of cruciferous vegetable intake to affect breast cancer risk may depend on the inherent metabolic activity. GSTs target a broad range of electrophilic compounds for conjugation with glutathione, which leads to a reduction in organic hydroepoxide concentrations (17). The role of GSTP1 in breast carcinogenesis remains unclear (18). A transition from an A to a G nucleotide position 313 leads to an Ile105Val amino acid change and, perhaps, also to greater thermal stability. Substrate specificity also may differ by GSTP1genotype: the GSTP1 Val allele is reported to have greater in vitro activity toward 1-chloro-2,4-dinitrobenzene (19). This may suggest an effect of the hydrophobic substrate–binding site. Several studies have reported an association of the GSTP1 Val/Val genotype with greater breast cancer risk (20–22), although subsequent studies reported mixed or conflicting results for the GSTP1 Val/Val polymorphism with respect to breast cancer (23–28). These inconsistencies in the relations between GSTP1 genetic polymorphism and breast cancer suggest that the effects of the GSTP1 genotype may depend on environmental factors such as cruciferous vegetable intake.
GSTs catalyze the conjugation of glutathione with isothiocyanates (electrophilic compounds) to facilitate membrane transport and excretion of isothiocyanates (29), thus, perhaps, first increasing the availability of isothiocyanates but ultimately reducing their systemic concentrations. A previous study by our group (30) found that urinary isothiocyanate concentrations are higher in Shanghai women with the GSTP1 Val/Val genotype than in those with other genotypes, which suggests that GSTP1 genotypes may affect the persistence of isothiocyanates in the body. Three earlier studies reported a combined effect of the genetic polymorphisms of GSTM1/T1/A1 and cruciferous vegetable intake on breast cancer (15, 16, 31). However, the combined effect of the GSTP1 Ile105Valpolymorphism and cruciferous vegetable intake on breast cancer risk has not been investigated. Thus, the goal of the present study was to investigate the relation among cruciferous vegetable intake, the GSTP1 genotype, and breast cancer risk.
SUBJECTS AND METHODS
Subjects
The Shanghai Breast Cancer Study (SBCS) is a population-based case-control study conducted in Shanghai, China. Detailed study methods were reported elsewhere (32). Cancer cases between 25 and 64 y of age were identified through a rapid case-ascertainment system, supplemented by the population-based Shanghai Cancer Registry, which provided a virtually complete ascertainment of incident breast cancer cases diagnosed by pathologists among urban Shanghai residents. From 1996 through 1998 (SBCS I), a total of 1598 eligible breast cancer cases were identified, of which 1455 (91%) completed in-person interviews. Characterization of tumors as estrogen receptor (ER)–or progesterone receptor (PR)–positive or –negative in SBCS I found that 52.8%, 10.8%, 10.5%, and 25.9% were defined as ER+/PR+, ER+/PR–, ER–/PR+, and ER–/PR–, respectively. Most cases (82.2%) were diagnosed with stage I or II cancer; 10.8% had stage III/IV cancer, and 7.0% had cancer of unknown stage (33). Controls were randomly selected from the general population of Shanghai by using the Shanghai Resident Registry, a population registry containing demographic information on all adult residents of urban Shanghai. The inclusion criteria for controls were identical to those for cases save for the cancer diagnosis. Of the 1724 eligible women, 1556 (90%) completed in-person interviews. To enhance the statistical power of the study, we recruited a second set of cases and controls between April 2002 and February 2005 (SBCS II) by using a protocol similar to that described above, although the age range of SBCS II was expanded to ages 20–70 y. A total of 1997 (84%) cases and 1918 (70%) controls were recruited to SBCS II, and information on ER/PR status will be reported in the future. Participants in SBCS II tended to be somewhat older, more educated, and more likely to be postmenopausal than were participants in SBCS I, perhaps because of the greater age range, but, overall, the participant characteristics in SBCS I and SBCS II were highly comparable.
A questionnaire was administered by in-person interview to elicit detailed information on demographic factors, menstrual and reproductive histories, hormone use, dietary habits, disease history, physical activity, tobacco and alcohol use, and family history of cancer. Current weight, circumferences of the waist and hip, and height while sitting and standing were also measured for all participants. In SBCS I, blood samples for research were obtained from 1193 (82%) cases and 1310 (84%) controls; in SBCS II, 1933 (97%) cases and 1857 (97%) controls who completed the in-person interview also donated a blood sample and buccal cells.
Genotyping
Genomic DNA was extracted from buffy coat fractions or buccal cells by using the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN) or the QIAmp DNA Mini-kit (Qiagen, Valencia, CA) according to each manufacturer’s protocol. DNA concentration were measured by using the PicoGreen dsDNA Quantitation Kit (Molecular Probes, Eugene, OR). Five to 10 ng of genomic DNA was used for each polymerase chain reaction (PCR). Quality-control (QC) samples (ie, water, CEPH 1347–02 DNA, and blinded and nonblinded DNA samples) were included in the genotyping assay.
For the SBCS I samples, the GSTP1 Ile105Val polymorphism (A313G, rs1695) was determined by the PCR-restriction fragment length polymorphism method reported previously (21). The PCR products were digested by using BsmAI restriction endonuclease. The PCR product with the G allele was digested to 2 fragments (148 and 41 bp), whereas the PCR product with the A allele remained undigested (189 bp). Genotyping was successfully completed for 1129 (95%) cases and 1236 (94%) controls in SBCS I.
For the 1897 (98%) cases and 1801 (97%) controls in SBCS II, the GSTP1 Ile105Valpolymorphism (rs1695) was assessed with the use of the ABI PRISM 7900 Sequence Detection System [Applied Biosystems (ABI), Foster City, CA] in the TaqMan genotyping assay with primers and probes obtained from ABI. The primers were 5′- CCTGGTGGACATGGTGAATGAC-3′ and 5′- TGGTGCAGATGCTCACATAGTTG –3′. The probes were VIC-CTGCAAATACATCTCC and FAM-CTGCAAATACGTCTCC. The TaqMan assay method was described previously (34). Briefly, the final volume for each reaction was 5 µL; it consisted of 2.5 µL TaqMan Universal PCR Master Mix, 0.6 µL of each primer, 0.2 µL of each TaqMan probe, and 5 ng genomic DNA. The PCR profile consisted of an initial denaturation step at 95 °C for 10 min and 40 cycles of 92 °C for 15 s and 60 °C for 1 min. The fluorescence level was measured with the ABI PRISM 7900HT sequence detector (Applied Biosystems). Allele frequencies were determined by using ABI SDS software (version 2.2; Applied Biosystems).
Genotyping was successfully completed for 1846 (95%) cases and 1727 (93%) controls in SBCS II. The laboratory staff was blind to the identity of the subjects. QC samples were included in the genotyping assays. Each 384-well plate contained 4 water, 8 CEPH 1347–02 DNA, and 8 blinded QC DNA samples. We genotyped the GSTP1 Ile105Val polymorphism in 45 DNA samples of the Chinese participants used in the International HapMap Project and 24 DNA samples used in Perlegen Sciences human genomic datasets as an additional QC step. The genotypes of the samples generated from the present study were compared with data downloaded from the International HapMap Project (Internet:http://www.hapmap.org) and Perlegen Sciences (Internet:http://genome.perlegen.com). The concordance rates for the QC samples were 98.3% and 100% for SBCS I and II, respectively. The rate of concordance between the data generated in our laboratory and the data from the above databases was 100%. GSTP1 genotypes did not significantly differ from Hardy-Weinberg equilibrium.
Dietary assessment
Habitual intakes of cruciferous vegetables were measured by using a validated food-frequency questionnaire (35). During the in-person interview, each participant was first asked how often each food item or food group was consumed and then asked how many liangs (1 liang = 50 g) of each food were eaten per unit of time (ie, d, wk, mo, or y) during the past 5 y. Five cruciferous vegetables common in Shanghai were listed as separate items on the food-frequency questionnaire, including Chinese greens (bok choy), green cabbage, Chinese cabbage (nappa), cauliflower, and white turnip. From this information, we calculated the average intake (in g/d) of each cruciferous vegetable. Furthermore, we estimated dietary isothiocyanate exposure by using previously published isothiocyanate concentrations for cruciferous vegetables grown in Singapore and cooked in boiling water (36). The report showed considerable variation in potential isothiocyanate contribution across the cruciferous vegetables analyzed, ranging from 4.9 µmol/100 g wet weight in bok choy (Braccica chinensis) to 81.3 µmol/100 g wet weight in watercress.
Statistical analysis
Separate analyses in SBCS I and II were comparable, and thus we pooled the SBCS I and II data for these analyses. Study participants were classified into 5 categories by quintile of the intake of each cruciferous vegetable. The lowest quintile served as the reference group in the analyses. Odds ratios (ORs) and 95% CIs summarizing the association between breast cancer risk and cruciferous vegetable intake or GSTP1 genotype were calculated by using unconditional logistic regression after adjustment for age, education, family history of breast cancer, age at menarche, body mass index (BMI; in kg/m2), age at first live birth, regular exercise, total energy intake, and study stage (SBCS I or II). Stratified analyses were performed to investigate any interaction or combined effect between the GSTP1 genotypes and cruciferous vegetable intake. We also repeated analyses after excluding the contribution of bok choy intake, because bok choy was frequently consumed in this study population but may have a lower isothiocyanate content than other cruciferous vegetables. Tests for interaction were performed by comparing the model with and without interaction terms by using a likelihood ratio test. All statistical tests were based on 2-sided probability. Statistical analyses were carried out with SAS software (version 9.1; SAS Institute, Cary, NC).
RESULTS
Breast cancer cases and controls were of a similar age and did not significantly differ in reported intakes of energy, total vegetables, fruit, or cruciferous vegetables. Significant case-control differences were observed with regard to education, family history of breast cancer, age at menarche, menopause status, age at menopause, age at first live birth, BMI, waist-to-hip ratio, regular exercise, and intakes of red meat, poultry, and fish (SBCS I and II combined; see Table 1
).
Total cruciferous vegetable intake was not significantly associated with premenopausal (P for trend = 0.859) or postmenopausal (P for trend = 0.142) breast cancer risk. On the other hand, estimated isothiocyanate exposure was significantly associated with lower breast cancer risk among women in quintile 5 (OR = 0.82; 95% CI: 0.70, 0.96; P for trend = 0.007), particularly the postmenopausal women (OR = 0.68; 95% CI: 0.53, 0.87; P for trend < 0.001). Turnip consumption was significantly associated with lower breast cancer risk among quintile 5 premenopausal (OR = 0.81; 95% CI: 0.67, 0.97; P for trend = 0.065) and postmenopausal (OR = 0.65; 95% CI: 0.52, 0.83; P for trend < 0.001) women, whereas Chinese cabbage was significantly associated with lower breast cancer risk among quintile 5 postmenopausal women (OR = 0.76; 95% CI: 0.60, 0.96; P for trend = 0.049). We removed bok choy from our total cruciferous vegetable intake score and found that intakes of the remaining cruciferous vegetables were significantly associated with lower postmenopausal breast cancer risk [from quintile 1 to quintile 5: OR = 1.00 (ref), 0.98, 0.77, 0.77, 0.83, and 0.76, respectively (95% CI: 0.58, 0.97); P for trend = 0.014]. We also found no association between total cruciferous vegetable intake minus bok choy and premenopausal breast cancer (data not shown).
The GSTP1Val allele was prevalent among 18.4% of controls. The GSTP1 Val/Valgenotype was associated with a significantly greater risk of breast cancer (OR = 1.50; 95% CI: 1.12, 1.99). The GSTP1 genotype x menopausal status interaction was not significant (P = 0.729); however, the association of GSTP1 genotype and menopausal status was significant in premenopausal women (OR = 1.69; 95% CI: 1.17, 2.43). Significant associations between the GSTP1 Val/Valgenotype and breast cancer were found in SBCS I (OR = 1.70; 95% CI: 1.09, 2.65 in all women; OR = 2.00; 95% CI: 1.16, 3.46 in premenopausal women), whereas associations identified in SBCS II were consistent with data from SBCS I but were not significant (OR = 1.35; 95% CI: 0.93, 1.97 in or all women; OR = 1.50; 95% CI: 0.92, 2.45 in premenopausal women).
The combined effect of total cruciferous vegetable intake and GSTP1 genotype on breast cancer risk. The GSTP1 Val/Val genotype combined with low cruciferous vegetable intake was associated with a 1.74-fold (95% CI = 1.13, 2.67) greater risk of breast cancer than was seen in women with the Ile/Ile or Ile/Val genotype and high intake of cruciferous vegetables. TheGSTP1 genotype was not significantly associated with breast cancer in women with high cruciferous vegetable intake. This association of the GSTP1 genotype and cruciferous vegetable intake was predominantly seen among premenopausal women (OR = 2.08; 95% CI = 1.20, 3.59), although tests for an interaction effect were not significant (Table 4). The combined effect of isothiocyanate estimates or cruciferous intake minus bok choy and the genetic polymorphism of GSTP1 Ile104Val were similar.
DISCUSSION
We examined the association among GSTP1 genotype, cruciferous vegetable intake, and breast cancer risk in a population-based case-control study of women living in Shanghai, China. Postmenopausal breast cancer risk was inversely associated with white turnip and Chinese cabbage intakes but not withGSTP1 genotypes. In contrast, the GSTP1 105Val homozygous substitution was significantly associated with a higher risk of premenopausal breast cancer. Women with the GSTP1 Val/Val genotype and low intake of cruciferous vegetables had a greater risk of breast cancer than did women with the Ile/Ile or Ile/Valgenotype and high intake of cruciferous vegetables; this greater risk was predominantly seen in premenopausal women.
Reports from Sweden and the United States (in premenopausal women) suggested a lower effect of high cruciferous vegetable intake on breast cancer risk (14, 15). Smith-Warner et al (11) found that broccoli and Brussels sprout consumption was associated with a 14% reduction in the risk in postmenopausal women. The associations between overall cruciferous vegetable intake and breast cancer risk seen in the present study were more consistent with the modest and nonsignificant associations observed in prior European Prospective Investigation into Cancer and Nutrition analyses (12). Nonetheless, we found white turnip and Chinese cabbage intakes to be inversely associated with breast cancer risk, predominantly among postmenopausal women. Turnip is consumed more regularly in Shanghai than in the West (36), and 66.3% of participants in this study reported consuming some amount of turnip. Wang et al (37) suggested that different cruciferous vegetables may not represent unique exposures because the glucosinolate profile varies across species. Similarly, Jiao et al (36) estimated turnip isothiocyanate concentrations to be ≈17-fold those of bok choy, which is a more widely consumed cruciferous vegetable in the Chinese population. Accordingly, associations between estimated isothiocyanate intake and breast cancer risk tracked well with associations between turnip intake and breast cancer risk, and total cruciferous vegetable intake was also associated with postmenopausal breast cancer when the intake of bok choy was excluded from the total cruciferous vegetable intake. Thus, our results suggest that turnip or other cruciferous vegetables with a high isothiocyanate content may reduce postmenopausal breast cancer risk. We cannot address the potential for systematic errors associated with applying isothiocyanate concentrations derived from cruciferous vegetables in Singapore (36) to our study population in Shanghai.
The GSTP1Val allele frequency of 18.4% in controls is more prevalent than that typically observed in white populations, which is usually ≈5–10% (20, 24, 38, 39). Zimniak et al (19) reported that the GSTP1 Val104 isoform differs in affinity for electrophilic substrates. Several earlier studies found no significant overall association between the GSTP1 Ile105Val polymorphism and breast cancer risk (23–26), and the GSTP1 Val allele has been associated with a lower risk in Finnish women, both premenopausal and postmenopausal (27), and in postmenopausal Korean women (28). However, we found the GSTP1 Val/Val genotype to be significantly associated with greater breast cancer risk, a finding that is consistent with the findings of other studies (20, 22) and previous analyses by our group (16, 21). The risk association with this polymorphism was more pronounced among premenopausal women, which is consistent with the common belief that genetic factors play a more important role in breast cancer diagnosed in young women than in that diagnosed in older women. Discrepancies between the results of the present study and those of earlier studies cannot be easily explained by the genetic variability associated with ethnicity or race alone, and they suggest that environmental factors such as cruciferous vegetable intake may affect the genetic predisposition to breast cancer associated with GSTP1genotype.
Dietary isothiocyanates induce GST enzyme activity (17, 40) and are associated with a reduction in indexes of systemic oxidative stress (7, 8). However, GSTs also conjugate isothiocyanates, and low GST activity could allow the protective effects of isothiocyanates to be exerted to a greater extent at the target tissue level. Overall, the results of epidemiologic studies to date most clearly support a combined GSTM1/T1-isothiocyanate effect on lung cancer risk, with more limited evidence for an effect on colon cancer risk (41). Limited data also suggest a GST-isothiocyanate effect on breast cancer risk (15, 16, 30). In the present study, high cruciferous vegetable intake reduced the strength of the association between theGSTP1 genetic polymorphisms and premenopausal breast cancer risk. We previously showed that urinary isothiocyanate concentrations are higher among Shanghai women with the GSTP1 Val/Val genotype than among those with other genotypes (30). Persons with the GSTP1 Val/Val genotype may excrete isothiocyanates more readily than those with another GSTP1 genotype, which may reduce the availability of isothiocyanates in the body and contribute to breast cancer risk. In such a situation, a low cruciferous vegetable intake would have the greatest effect among women with the GSTP1 Val/Val genotype. In contrast, higher cruciferous vegetable intake and isothiocyanate exposure may compensate to a degree for the greater isothiocyanate excretion observed with the GSTP1 Val/Val genotype.
These results could be affected by sources of bias that are common to case-control studies (eg, recall bias), although our rapid recruitment protocol was designed to minimize such sources of bias. Moreover, selection bias associated with diet or genotype is less likely, because of the high participation rates and population-based study design. Myrosinase activity and isothiocyanate availability may be affected by the method of food preparation (42, 43). Turnips are often consumed in an uncooked state in Shanghai, whereas most cruciferous vegetables are consumed after light cooking or stir-frying or in soups. It is unlikely that cooking methods vary substantially between cases and controls. Despite the pooling of data from 2 large studies, data within specific strata for analyses investigating the effects of cruciferous intake by genotype were sparse, and the observed patterns should be confirmed in other studies. Urinary isothiocyanate concentrations as a biomarker of cruciferous vegetable intake and internalized isothiocyanate exposure were not available for this analysis, but they will be investigated in the future. Nonetheless, this population-based study includes a sample size large enough to allow detection of relatively small associations and to explore combined gene-diet effects after adjustment for potentially confounding factors. Furthermore, total cruciferous vegetable intake was considered in a large number of subjects with high cruciferous vegetable intakes, and the evaluation included various cruciferous vegetables not as commonly consumed in other populations.
In summary, the cancer-preventive potential of cruciferous vegetable is believed to derive, in part, from the effects of isothiocyanates and other glucosinolate derivatives on phase II enzyme activity (2, 36). Greater intake of cruciferous vegetables with a higher isothiocyanate content was associated with lower postmenopausal breast cancer risk. In addition, we found that the GSTP1 Val/Valgenotype was associated with a greater breast cancer risk, and premenopausal breast cancer risk was attenuated among women with a high cruciferous vegetable intake. This may suggest that a genetic predisposition to breast cancer related to GSTP1 genotype could be modified by cruciferous vegetable intake.
Read full Original Study for References
Another “China Study” defines best dietary practices for minimizing and reversing the incidence of major chronic disease
Watch documentary films about natural health diets as natural cancer cure.
Total Health Naturopathy for personal consulting and guidance for all health conditions
Healthforce Nutritionals Ordering Instructions
Healthforce Nutritionals Ordering Instructions
Total Health Fx Is An Affiliate of Healthforce Nutritionals
- #1 SOURCE FOR RAW, VEGAN, BIO-COMPATIBLE NUTRITIONAL SUPERFOODS!™ 100% HARD-CORE!
- Naturally and sustainably grown materials verified by proprietary TruGanic™ standards for actual purity
- Maximum therapeutic value and nutrient density
- 100% Gluten-Free, 100% RAW (from the start)
- Eco-Fresh™ Amber Glass Packaging.
Vitamineral Green™ − 500 Grams (17.65 Ounces) Powder
Vitamineral Green™ is a superior, nutritionally dense, therapeutic green superfood powder which nutritionally supports blood sugar, detoxification, the immune system, liver, kidneys, blood, bones, colon, pancreas, muscles, brain, regularity, cRegular Price: $74.94
Nutritional Partner Price: $59.95 What is NPP? 
You Save: 20.00%
Liver Rescue™ 4+ Liver Support 120 VeganCaps™
Liver Rescue™ Powerfully supports liver function cleansing & regeneration! Keeping the liver healthy is essential to good health. Contains: Milk Thistle, Dandelion Root Extract, Wasabia Japonica, Picrorhiza Kurroa.
[Product Details...]
[Product Details...]
- Regular Price: $37.44
- Nutritional Partner Price: $29.95 What is NPP?
- You Save: 20.00%
Intestinal Drawing Formula 408 grams
Nutritionally Supports nourishing, soothing lubrication, plus the Drawing and elimination of toxins from the entire intestinal tract.
[Product Details...]
[Product Details...]
- Regular Price: $37.44
- Nutritional Partner Price: $29.95 What is NPP?
- You Save: 20.00%
-
Intestinal Movement Formula 50 VeganCaps™
INTESTINAL MOVEMENT FORMULA Version 5 Effective, Gentle, & Balanced- Not habit forming!
[Product Details...]
[Product Details...]
- Regular Price: $21.19
- Nutritional Partner Price: $16.95 What is NPP?
- You Save: 20.00%
WarriorForce™ Sports Nutrition
Warrior Food Chocolate Phycocyanin, Vegan Protein, 250 gm
Warrior Food™ Chocolate Phycocyanin: Complete Protein This is the best protein formula available. Organic • Non Toxic • Vegan • Raw • Hard Core. Easy to absorb and assimilate therefore you need less protein. Enhanced Nutritionally with Phycocyanin and Enzymes
[Product Details...]
[Product Details...]
- Regular Price: $31.19
- Nutritional Partner Price: $24.95 What is NPP?
- You Save: 20.00%
Warrior Food Vanilla Phycocyanin, Vegan Protein, 250 gm
Warrior Food™ Vanilla Enhanced: Complete Protein This is the best protein formula available. Organic • Non Toxic • Vegan • Raw • Hard Core. Easy to absorb and assimilate therefore you need less protein. Enhanced Nutritionally with Phycocyanin and Enzymes
[Product Details...]
[Product Details...]
- Regular Price: $31.19
- Nutritional Partner Price: $24.95 What is NPP?
- You Save: 20.00%
How to Physically Relax When You Can’t Take the Time
How to Physically Relax When You Can’t Take the Time
In talking with a massage client recently about his need to physically relax his sports-induced muscles on a regular basis. He related he couldn’t find the time to stretch or soak his body in a hot bath. You may have felt this way yourself where taking the time to relax, unwind, to stretch or soak seems un-doable, but of course you take a shower!
This reminded me of a personal story of when I was living and working at a mineral and mud bath resort many years ago. I was about to take a 3 month trip overseas where I would not have the facility to soak in hot mineral water or have a hot mud bath regularly as living at the resort. I thought that if I could make up a mix of some powdered ingredients for easy transport that I could shower with, it might slightly resemble the effects of a hot mineral or mud bath.
I found that my mix of powdered ingredients was far more relaxing than I actually imagined. I share this with you for you to enjoy – make up a batch and have it on hand in your shower or bath to use whenever; my source for the ingredients follows:
-
One-third Boraxo Hand Soap powder
-
One-third Herbo-Mineral Clay powder
-
One-third Salt: your choice of Table Salt, Sea Salt, or Epsom Salt – cheap enough to buy on your own from any grocery or pharmacy
-
Mix these ingredients together to store in a plastic container and keep handy to soak or shower with.
-
In a smaller container for one-time usage, mix one to two handfuls with just enough water to mix the ingredients and have it be a bit sloshy and no longer powdery.
-
Apply and scrub all over the body.
-
You’ll find it cleanses, detoxifies and exfoliates the skin, brings the natural body oils to the surface, and totally relieves the body of tension and the mind of stress.
-
Easy cleanup – just spray down shower or bath while residue is still moist
-
Here’s how to inexpensively buy the necessary ingredients – just click on the links to check them out and order:
Table Salt, Sea Salt or Epsom Salt -cheap enough to buy on your own!
Auromere Ayurvedic Herbo-Mineral Mud Bath Powder *
* your choice of sizes and amounts available
Boraxo Powdered Hand Soap *
* your choice of sizes and amounts available
By the way, a Total Health Massage is an easy way to physically and mentally relax, gets pain out of the body and stress out of your mind; try one weekly or monthly!
Documentaries about Natural Cure with Plant-Based Diets
Documentaries about Natural Cure with Plant-Based Diets
At Total Health Fx, we are strong proponents of plant-based diets for prevention, remedy & wellness. The following movie documentaries about natural cure with plant-based diets are gladly shared with you whether you are totally healthy now or looking to get well or are in recovery. We hope they are in inspiration to you to have a Totally Healthy Lifestyle.
Get “The Gerson Therapy” Instructional Book
Get “The Food Matters Cookbook”
-
Forks Over Knives (watch on Hulu)
Get “Forks Over Knives: The Plant-Based Way to Health” Book
Get “Forks Over Knives – A Year of Meals” Book
Get the “Fat, Sick & Nearly Dead” Book
Dying to Have Known
Get “The Beautiful Truth” Book
-
Eating - register, then view
Get The “Rave Eating” Diet and Lifestyle Book
Need Personal Guidance for Natural Cure
with Plant-Based Diets ?
See what Total Health’s Kathi Fox, Ph.D. Naturopathy, can do for you !
Foods & Goods for Plant-Based Diets:
SoCal 951-677-8822 Nation-wide 800-557-6821
“Happy Cow” Animal Ingredients to Avoid
“Happy Cow” Animal Ingredients to Avoid
Happy Cow is a website that serves as a guide to vegetarian and vegan restaurants, and natural health food stores. Happy Cow also provides great information regarding vegetarian and vegan nutrition and recipes.
Vegans and vegetarians alike are often unaware that products they like may contain animal ingredients and/or by-products of animals such as the ones contained in the following list. Those following vegan and vegetarian diets would want to avoid eating animal ingredients. This list is handy to keep with you when you’re going grocery shopping. Animal ingredients are often called by their obscure technical names. So here is a list helpful list to fold up and keep in your wallet or purse. *Ingredients listed in an asterisk are ones that sometimes come from plants or have synthetic alternatives. We have been informed that some of the compounds listed below, while could be obtained from animal products, haven’t been obtained from animals for many years due to the fact that they are readily industrially synthesized and cheaper to get than to go through the process of obtaining them from animal products.
Happy Cow Animal Ingredients-to-Avoid Animal Ingredient List A – Z
Keep It Simple, Keep It Whole
Keep It Simple, Keep It Whole
Your Guide to Optimal Health
Keep It Simple, Keep It Whole; is an easy to read book that compiles the essential nutrition and health information you need to obtain optimal health. With fun, short chapters and bold take home messages, it is perfect for people who want to solidify their current nutrition and health knowledge base as well as for those to whom you want to gently introduce a truly healthy diet and lifestyle. Take advantage of this amazing and affordable opportunity to optimize your health and finally overcome the obstacles that have been standing in the way of your success.
The China Study
The China Study
Purchase The China Study on Amazon The Most Comprehensive Study of Nutrition Ever Conducted and the Startling Implications for Diet, Weight Loss and Long-Term HealthThe China Study is the definitive work that scientifically shows research supporting the plant-based vegan diet in its unique role of minimizing and reversing the occurence of chronic disease, correlating the cause to cholesterol derived from animal protein. Total Health Fx has been an active proponent of the vegan diet for many years, recommending to our clients for prevention, remedy, and wellness.
“This exhaustive presentation of the findings from the China Study conclusively demonstrates the link between nutrition and heart disease, diabetes, and cancer. Referred to as the “Grand Prix of epidemiology” by The New York Times, this study examines more than 350 variables of health and nutrition with surveys from 6,500 adults in 65 counties, representing 2,500 counties across rural China and Taiwan. While revealing that proper nutrition can have a dramatic effect on reducing and reversing these ailments as well as obesity, this text calls into question the practices of many of the current dietary programs, such as the Atkins diet, that enjoy widespread popularity in the West. The impact of the politics of nutrition and the efforts of special interest groups on the creation and dissemination of public information on nutrition are also discussed.” Total Health Fx recommends reading the full, documented review of The China Study on Wikipedia.
