By China News Center

In another boon for broccoli, researchers have found that eating the green vegetable may improve outcomes after a breast cancer diagnosis. A new study points to the positive role that all cruciferous veggies — like cauliflower, brussels sprouts, kale and cabbage — can play in improving survival and recurrence rates associated with breast cancer.

In the study, presented Tuesday at the American Association for Cancer Research’s annual meeting, researchers looked at data from more than 4,800 breast cancer survivors in China who had been diagnosed with breast cancer between 2002 and 2006. The women’s cancers ranged from stage 1 to stage 4.

Overall, researchers with the Vanderbilt Epidemiology Center and Shanghai Centers for Disease Control and Prevention found that higher consumption of cruciferous vegetables in the years following diagnosis was tied to better outcomes. Women who ate the most reduced by 62 percent their risk of both overall mortality and breast cancer-specific mortality, as compared to women who consumed the least. Those who consumed the most vegetables also reduced by 35 percent the risk of their breast cancer coming back. Researchers compared relative quantities of the vegetables in women’s diets and have not determined at what quantities the beneficial effects are derived.

“Cruciferous vegetables, such as cauliflower, cabbage, bok choy, turnips and broccoli, contain high amounts of glucosinolates, which are hydrolyzed to bioactive compounds including isothiocyanates (ITCs) and indoles,” said Sarah Nechuta, a research fellow in Vanderbilt University’s epidemiology center and a researcher on the new study, who explained that she and her fellow researchers attempted to control for other factors that might influence women’s outcomes, including demographics, exercise and additional dietary behaviors.

“These bioactive compounds have many anti-cancer properties that may influence cancer development, progression and survival,” Nechuta added.

This is not the first time that the cabbage family has been tied to decreased breast cancer risk.

A 2008 study in The American Journal of Clinical Nutrition  (see below) which also focused on Chinese women, linked consumption of cabbage and white turnips to lower breast cancer risk.

“An association has also been established with colon cancer and prostate cancer,” explained Emily Ho, an associate professor in nutrition and exercise sciences at Oregon State University. “There is pretty strong evidence from studies that compounds found in cruciferous vegetables may have cancer-fighting properties.”

The new study is, however, among the first to look at the role that cruciferous vegetables can play aftera cancer diagnosis.

But Ho cautioned that many questions about the connection between vegetables and cancer risk remain.

“There are still a lot of unanswered questions about what, exactly, is in [cruciferous vegetables] that is protective,” she said. Researchers do not understand exactly what the underlying mechanisms are and what impact these vegetables may have at the tissue level, she said. Furthermore, research has not yet made it clear whether supplements could have the same potential effect as vegetables themselves seem to have.

Nechuta also cautioned that it should not necessarily be assumed that similar results would be achieved in the United States, where the types of cruciferous vegetables women eat may be different than those in China.

“Commonly consumed cruciferous vegetables in China include turnips, Chinese cabbage [or] bok coy and greens, while broccoli and brussels sprouts are the more commonly consumed cruciferous vegetables in the United States and other Western countries,” Nechuta said in a statement. In an email to The Huffington Post, she said that future studies with direct measurements of various bioactive compounds are needed in order to understand the possible link between cruciferous vegetables and breast cancer intake.

In the meantime, Ho said people would do well to follow fruit and vegetable consumption guidelines.The American Cancer Society, for example, recommends that individuals consume at least two and a half cups of fruits and vegetables per day to lower cancer risk, pointing out that those foods with the most color — which are dark green, red, yellow and orange — provide the most nutrients.

“If you try and include cruciferous vegetables as some of those servings,” Ho said. “It probably won’t hurt and it certainly might help.”

American Journal of Clinical Nutrition, Vol. 87, No. 3, 753-760, March 2008
© 2008 American Society for Nutrition

Cruciferous vegetables, the GSTP1 Ile¹⁰⁵Val genetic polymorphism, and breast cancer risk

ABSTRACT

Key Words: Cruciferous vegetables • GSTP1 genetic polymorphism • breast cancer risk • gene-diet combined effect

INTRODUCTION

Cruciferous vegetable are an especially rich source of glucosinolates, which may be converted by plant myrosinase and the gastrointestinal microflora to isothiocyanates, indole-3-carbinol, and other compounds believed to have anticancer properties. These agents may affect carcinogenesis through several mechanisms, including the induction of apoptosis and a shift in estrogen metabolism to favor metabolites with lower estrogenic activity (1, 2). In addition, isothiocyanates induce multiple phase II conjugating enzyme systems (3, 4), including glutathione S-transferases (GSTs), through nuclear transcription factor–E2–related factor 2–enhanced transcription (5, 6). The overall effects of cruciferous vegetable intake appear to be a reduction in systemic oxidative stress (7) and a suppression of mutagenic and carcinogenic activity (8). Indeed, cruciferous vegetable intake has been inversely associated with the risk of lung, stomach, colorectal, bladder, and other cancers (9, 10). However, despite strong biologic plausibility, the relation between cruciferous vegetable intake and breast cancer risk is unclear. Several studies found no association between total or cruciferous vegetable intake and breast cancer risk (10–13). In contrast, case-control studies from Sweden (14), the United States (in premenopausal women) (15), and Shanghai (16) reported a reduction in breast cancer risk associated with cruciferous vegetable intake.

The capacity of cruciferous vegetable intake to affect breast cancer risk may depend on the inherent metabolic activity. GSTs target a broad range of electrophilic compounds for conjugation with glutathione, which leads to a reduction in organic hydroepoxide concentrations (17). The role of GSTP1 in breast carcinogenesis remains unclear (18). A transition from an A to a G nucleotide position 313 leads to an Ile¹⁰⁵Val amino acid change and, perhaps, also to greater thermal stability. Substrate specificity also may differ by GSTP1genotype: the GSTP1 Val allele is reported to have greater in vitro activity toward 1-chloro-2,4-dinitrobenzene (19). This may suggest an effect of the hydrophobic substrate–binding site. Several studies have reported an association of the GSTP1 Val/Val genotype with greater breast cancer risk (20–22), although subsequent studies reported mixed or conflicting results for the GSTP1 Val/Val polymorphism with respect to breast cancer (23–28). These inconsistencies in the relations between GSTP1 genetic polymorphism and breast cancer suggest that the effects of the GSTP1 genotype may depend on environmental factors such as cruciferous vegetable intake.

Breast cancer cases and controls were of a similar age and did not significantly differ in reported intakes of energy, total vegetables, fruit, or cruciferous vegetables. Significant case-control differences were observed with regard to education, family history of breast cancer, age at menarche, menopause status, age at menopause, age at first live birth, BMI, waist-to-hip ratio, regular exercise, and intakes of red meat, poultry, and fish. Menopause estrogen levels should always be correctly balanced after menopause, or those can lead to various kind of diseases or illness, Dim Supplement is a good option to work really quick on estrogen irregular levels.

Total cruciferous vegetable intake was not significantly associated with premenopausal (P for trend = 0.859) or postmenopausal (P for trend = 0.142) breast cancer risk. On the other hand, estimated isothiocyanate exposure was significantly associated with lower breast cancer risk among women in quintile 5 (OR = 0.82; 95% CI: 0.70, 0.96; P for trend = 0.007), particularly the postmenopausal women (OR = 0.68; 95% CI: 0.53, 0.87; P for trend < 0.001). Turnip consumption was significantly associated with lower breast cancer risk among quintile 5 premenopausal (OR = 0.81; 95% CI: 0.67, 0.97; P for trend = 0.065) and postmenopausal (OR = 0.65; 95% CI: 0.52, 0.83; P for trend < 0.001) women, whereas Chinese cabbage was significantly associated with lower breast cancer risk among quintile 5 postmenopausal women (OR = 0.76; 95% CI: 0.60, 0.96; P for trend = 0.049). We removed bok choy from our total cruciferous vegetable intake score and found that intakes of the remaining cruciferous vegetables were significantly associated with lower postmenopausal breast cancer risk [from quintile 1 to quintile 5: OR = 1.00 (ref), 0.98, 0.77, 0.77, 0.83, and 0.76, respectively (95% CI: 0.58, 0.97); P for trend = 0.014]. We also found no association between total cruciferous vegetable intake minus bok choy and premenopausal breast cancer (data not shown).

GSTs catalyze the conjugation of glutathione with isothiocyanates (electrophilic compounds) to facilitate membrane transport and excretion of isothiocyanates (29), thus, perhaps, first increasing the availability of isothiocyanates but ultimately reducing their systemic concentrations. A previous study by our group (30) found that urinary isothiocyanate concentrations are higher in Shanghai women with the GSTP1 Val/Val genotype than in those with other genotypes, which suggests that GSTP1 genotypes may affect the persistence of isothiocyanates in the body. Three earlier studies reported a combined effect of the genetic polymorphisms of GSTM1/T1/A1 and cruciferous vegetable intake on breast cancer (15, 16, 31). However, the combined effect of the GSTP1 Ile¹⁰⁵Valpolymorphism and cruciferous vegetable intake on breast cancer risk has not been investigated. Thus, the goal of the present study was to investigate the relation among cruciferous vegetable intake, the GSTP1 genotype, and breast cancer risk.

SUBJECTS AND METHODS

Subjects
The Shanghai Breast Cancer Study (SBCS) is a population-based case-control study conducted in Shanghai, China. Detailed study methods were reported elsewhere (32). Cancer cases between 25 and 64 y of age were identified through a rapid case-ascertainment system, supplemented by the population-based Shanghai Cancer Registry, which provided a virtually complete ascertainment of incident breast cancer cases diagnosed by pathologists among urban Shanghai residents. From 1996 through 1998 (SBCS I), a total of 1598 eligible breast cancer cases were identified, of which 1455 (91%) completed in-person interviews. Characterization of tumors as estrogen receptor (ER)–or progesterone receptor (PR)–positive or –negative in SBCS I found that 52.8%, 10.8%, 10.5%, and 25.9% were defined as ER+/PR+, ER+/PR–, ER–/PR+, and ER–/PR–, respectively. Most cases (82.2%) were diagnosed with stage I or II cancer; 10.8% had stage III/IV cancer, and 7.0% had cancer of unknown stage (33). Controls were randomly selected from the general population of Shanghai by using the Shanghai Resident Registry, a population registry containing demographic information on all adult residents of urban Shanghai. The inclusion criteria for controls were identical to those for cases save for the cancer diagnosis. Of the 1724 eligible women, 1556 (90%) completed in-person interviews. To enhance the statistical power of the study, we recruited a second set of cases and controls between April 2002 and February 2005 (SBCS II) by using a protocol similar to that described above, although the age range of SBCS II was expanded to ages 20–70 y. A total of 1997 (84%) cases and 1918 (70%) controls were recruited to SBCS II, and information on ER/PR status will be reported in the future. Participants in SBCS II tended to be somewhat older, more educated, and more likely to be postmenopausal than were participants in SBCS I, perhaps because of the greater age range, but, overall, the participant characteristics in SBCS I and SBCS II were highly comparable.

A questionnaire was administered by in-person interview to elicit detailed information on demographic factors, menstrual and reproductive histories, hormone use, dietary habits, disease history, physical activity, tobacco and alcohol use, and family history of cancer. Current weight, circumferences of the waist and hip, and height while sitting and standing were also measured for all participants. In SBCS I, blood samples for research were obtained from 1193 (82%) cases and 1310 (84%) controls; in SBCS II, 1933 (97%) cases and 1857 (97%) controls who completed the in-person interview also donated a blood sample and buccal cells.

Genotyping
Genomic DNA was extracted from buffy coat fractions or buccal cells by using the Puregene DNA Isolation Kit (Gentra Systems, Minneapolis, MN) or the QIAmp DNA Mini-kit (Qiagen, Valencia, CA) according to each manufacturer’s protocol. DNA concentration were measured by using the PicoGreen dsDNA Quantitation Kit (Molecular Probes, Eugene, OR). Five to 10 ng of genomic DNA was used for each polymerase chain reaction (PCR). Quality-control (QC) samples (ie, water, CEPH 1347–02 DNA, and blinded and nonblinded DNA samples) were included in the genotyping assay.

For the SBCS I samples, the GSTP1 Ile¹⁰⁵Val polymorphism (A313G, rs1695) was determined by the PCR-restriction fragment length polymorphism method reported previously (21). The PCR products were digested by using BsmAI restriction endonuclease. The PCR product with the G allele was digested to 2 fragments (148 and 41 bp), whereas the PCR product with the A allele remained undigested (189 bp). Genotyping was successfully completed for 1129 (95%) cases and 1236 (94%) controls in SBCS I.

For the 1897 (98%) cases and 1801 (97%) controls in SBCS II, the GSTP1 Ile¹⁰⁵Valpolymorphism (rs1695) was assessed with the use of the ABI PRISM 7900 Sequence Detection System [Applied Biosystems (ABI), Foster City, CA] in the TaqMan genotyping assay with primers and probes obtained from ABI. The primers were 5′- CCTGGTGGACATGGTGAATGAC-3′ and 5′- TGGTGCAGATGCTCACATAGTTG –3′. The probes were VIC-CTGCAAATACATCTCC and FAM-CTGCAAATACGTCTCC. The TaqMan assay method was described previously (34). Briefly, the final volume for each reaction was 5 µL; it consisted of 2.5 µL TaqMan Universal PCR Master Mix, 0.6 µL of each primer, 0.2 µL of each TaqMan probe, and 5 ng genomic DNA. The PCR profile consisted of an initial denaturation step at 95 °C for 10 min and 40 cycles of 92 °C for 15 s and 60 °C for 1 min. The fluorescence level was measured with the ABI PRISM 7900HT sequence detector (Applied Biosystems). Allele frequencies were determined by using ABI SDS software (version 2.2; Applied Biosystems).

Genotyping was successfully completed for 1846 (95%) cases and 1727 (93%) controls in SBCS II. The laboratory staff was blind to the identity of the subjects. QC samples were included in the genotyping assays. Each 384-well plate contained 4 water, 8 CEPH 1347–02 DNA, and 8 blinded QC DNA samples. We genotyped the GSTP1 Ile¹⁰⁵Val polymorphism in 45 DNA samples of the Chinese participants used in the International HapMap Project and 24 DNA samples used in Perlegen Sciences human genomic datasets as an additional QC step. The genotypes of the samples generated from the present study were compared with data downloaded from the International HapMap Project (Internet:http://www.hapmap.org) and Perlegen Sciences (Internet:http://genome.perlegen.com). The concordance rates for the QC samples were 98.3% and 100% for SBCS I and II, respectively. The rate of concordance between the data generated in our laboratory and the data from the above databases was 100%. GSTP1 genotypes did not significantly differ from Hardy-Weinberg equilibrium.

Dietary assessment
Habitual intakes of cruciferous vegetables were measured by using a validated food-frequency questionnaire (35). During the in-person interview, each participant was first asked how often each food item or food group was consumed and then asked how many liangs (1 liang = 50 g) of each food were eaten per unit of time (ie, d, wk, mo, or y) during the past 5 y. Five cruciferous vegetables common in Shanghai were listed as separate items on the food-frequency questionnaire, including Chinese greens (bok choy), green cabbage, Chinese cabbage (nappa), cauliflower, and white turnip. From this information, we calculated the average intake (in g/d) of each cruciferous vegetable. Furthermore, we estimated dietary isothiocyanate exposure by using previously published isothiocyanate concentrations for cruciferous vegetables grown in Singapore and cooked in boiling water (36). The report showed considerable variation in potential isothiocyanate contribution across the cruciferous vegetables analyzed, ranging from 4.9 µmol/100 g wet weight in bok choy (Braccica chinensis) to 81.3 µmol/100 g wet weight in watercress.

Statistical analysis
Separate analyses in SBCS I and II were comparable, and thus we pooled the SBCS I and II data for these analyses. Study participants were classified into 5 categories by quintile of the intake of each cruciferous vegetable. The lowest quintile served as the reference group in the analyses. Odds ratios (ORs) and 95% CIs summarizing the association between breast cancer risk and cruciferous vegetable intake or GSTP1 genotype were calculated by using unconditional logistic regression after adjustment for age, education, family history of breast cancer, age at menarche, body mass index (BMI; in kg/m²), age at first live birth, regular exercise, total energy intake, and study stage (SBCS I or II). Stratified analyses were performed to investigate any interaction or combined effect between the GSTP1 genotypes and cruciferous vegetable intake. We also repeated analyses after excluding the contribution of bok choy intake, because bok choy was frequently consumed in this study population but may have a lower isothiocyanate content than other cruciferous vegetables. Tests for interaction were performed by comparing the model with and without interaction terms by using a likelihood ratio test. All statistical tests were based on 2-sided probability. Statistical analyses were carried out with SAS software (version 9.1; SAS Institute, Cary, NC).

The GSTP1Val allele was prevalent among 18.4% of controls. The GSTP1 Val/Valgenotype was associated with a significantly greater risk of breast cancer (OR = 1.50; 95% CI: 1.12, 1.99). The GSTP1 genotype x menopausal status interaction was not significant (P = 0.729); however, the association of GSTP1 genotype and menopausal status was significant in premenopausal women (OR = 1.69; 95% CI: 1.17, 2.43). Significant associations between the GSTP1 Val/Valgenotype and breast cancer were found in SBCS I (OR = 1.70; 95% CI: 1.09, 2.65 in all women; OR = 2.00; 95% CI: 1.16, 3.46 in premenopausal women), whereas associations identified in SBCS II were consistent with data from SBCS I but were not significant (OR = 1.35; 95% CI: 0.93, 1.97 in or all women; OR = 1.50; 95% CI: 0.92, 2.45 in premenopausal women).

The combined effect of total cruciferous vegetable intake and GSTP1 genotype on breast cancer risk. The GSTP1 Val/Val genotype combined with low cruciferous vegetable intake was associated with a 1.74-fold (95% CI = 1.13, 2.67) greater risk of breast cancer than was seen in women with the Ile/Ile or Ile/Val genotype and high intake of cruciferous vegetables. TheGSTP1 genotype was not significantly associated with breast cancer in women with high cruciferous vegetable intake. This association of the GSTP1 genotype and cruciferous vegetable intake was predominantly seen among premenopausal women (OR = 2.08; 95% CI = 1.20, 3.59), although tests for an interaction effect were not significant (Table 4). The combined effect of isothiocyanate estimates or cruciferous intake minus bok choy and the genetic polymorphism of GSTP1 Ile¹⁰⁴Val were similar.

DISCUSSION

We examined the association among GSTP1 genotype, cruciferous vegetable intake, and breast cancer risk in a population-based case-control study of women living in Shanghai, China. Postmenopausal breast cancer risk was inversely associated with white turnip and Chinese cabbage intakes but not withGSTP1 genotypes. In contrast, the GSTP1 ¹⁰⁵Val homozygous substitution was significantly associated with a higher risk of premenopausal breast cancer. Women with the GSTP1 Val/Val genotype and low intake of cruciferous vegetables had a greater risk of breast cancer than did women with the Ile/Ile or Ile/Valgenotype and high intake of cruciferous vegetables; this greater risk was predominantly seen in premenopausal women.

Reports from Sweden and the United States (in premenopausal women) suggested a lower effect of high cruciferous vegetable intake on breast cancer risk (14, 15). Smith-Warner et al (11) found that broccoli and Brussels sprout consumption was associated with a 14% reduction in the risk in postmenopausal women. The associations between overall cruciferous vegetable intake and breast cancer risk seen in the present study were more consistent with the modest and nonsignificant associations observed in prior European Prospective Investigation into Cancer and Nutrition analyses (12). Nonetheless, we found white turnip and Chinese cabbage intakes to be inversely associated with breast cancer risk, predominantly among postmenopausal women. Turnip is consumed more regularly in Shanghai than in the West (36), and 66.3% of participants in this study reported consuming some amount of turnip. Wang et al (37) suggested that different cruciferous vegetables may not represent unique exposures because the glucosinolate profile varies across species. Similarly, Jiao et al (36) estimated turnip isothiocyanate concentrations to be ≈17-fold those of bok choy, which is a more widely consumed cruciferous vegetable in the Chinese population. Accordingly, associations between estimated isothiocyanate intake and breast cancer risk tracked well with associations between turnip intake and breast cancer risk, and total cruciferous vegetable intake was also associated with postmenopausal breast cancer when the intake of bok choy was excluded from the total cruciferous vegetable intake. Thus, our results suggest that turnip or other cruciferous vegetables with a high isothiocyanate content may reduce postmenopausal breast cancer risk. We cannot address the potential for systematic errors associated with applying isothiocyanate concentrations derived from cruciferous vegetables in Singapore (36) to our study population in Shanghai.

The GSTP1Val allele frequency of 18.4% in controls is more prevalent than that typically observed in white populations, which is usually ≈5–10% (20, 24, 38, 39). Zimniak et al (19) reported that the GSTP1 Val104 isoform differs in affinity for electrophilic substrates. Several earlier studies found no significant overall association between the GSTP1 Ile¹⁰⁵Val polymorphism and breast cancer risk (23–26), and the GSTP1 Val allele has been associated with a lower risk in Finnish women, both premenopausal and postmenopausal (27), and in postmenopausal Korean women (28). However, we found the GSTP1 Val/Val genotype to be significantly associated with greater breast cancer risk, a finding that is consistent with the findings of other studies (20, 22) and previous analyses by our group (16, 21). The risk association with this polymorphism was more pronounced among premenopausal women, which is consistent with the common belief that genetic factors play a more important role in breast cancer diagnosed in young women than in that diagnosed in older women. Discrepancies between the results of the present study and those of earlier studies cannot be easily explained by the genetic variability associated with ethnicity or race alone, and they suggest that environmental factors such as cruciferous vegetable intake may affect the genetic predisposition to breast cancer associated with GSTP1genotype.

Dietary isothiocyanates induce GST enzyme activity (17, 40) and are associated with a reduction in indexes of systemic oxidative stress (7, 8). However, GSTs also conjugate isothiocyanates, and low GST activity could allow the protective effects of isothiocyanates to be exerted to a greater extent at the target tissue level. Overall, the results of epidemiologic studies to date most clearly support a combined GSTM1/T1-isothiocyanate effect on lung cancer risk, with more limited evidence for an effect on colon cancer risk (41). Limited data also suggest a GST-isothiocyanate effect on breast cancer risk (15, 16, 30). In the present study, high cruciferous vegetable intake reduced the strength of the association between theGSTP1 genetic polymorphisms and premenopausal breast cancer risk. We previously showed that urinary isothiocyanate concentrations are higher among Shanghai women with the GSTP1 Val/Val genotype than among those with other genotypes (30). Persons with the GSTP1 Val/Val genotype may excrete isothiocyanates more readily than those with another GSTP1 genotype, which may reduce the availability of isothiocyanates in the body and contribute to breast cancer risk. In such a situation, a low cruciferous vegetable intake would have the greatest effect among women with the GSTP1 Val/Val genotype. In contrast, higher cruciferous vegetable intake and isothiocyanate exposure may compensate to a degree for the greater isothiocyanate excretion observed with the GSTP1 Val/Val genotype.

These results could be affected by sources of bias that are common to case-control studies (eg, recall bias), although our rapid recruitment protocol was designed to minimize such sources of bias. Moreover, selection bias associated with diet or genotype is less likely, because of the high participation rates and population-based study design. Myrosinase activity and isothiocyanate availability may be affected by the method of food preparation (42, 43). Turnips are often consumed in an uncooked state in Shanghai, whereas most cruciferous vegetables are consumed after light cooking or stir-frying or in soups. It is unlikely that cooking methods vary substantially between cases and controls. Despite the pooling of data from 2 large studies, data within specific strata for analyses investigating the effects of cruciferous intake by genotype were sparse, and the observed patterns should be confirmed in other studies. Urinary isothiocyanate concentrations as a biomarker of cruciferous vegetable intake and internalized isothiocyanate exposure were not available for this analysis, but they will be investigated in the future. Nonetheless, this population-based study includes a sample size large enough to allow detection of relatively small associations and to explore combined gene-diet effects after adjustment for potentially confounding factors. Furthermore, total cruciferous vegetable intake was considered in a large number of subjects with high cruciferous vegetable intakes, and the evaluation included various cruciferous vegetables not as commonly consumed in other populations.

In summary, the cancer-preventive potential of cruciferous vegetable is believed to derive, in part, from the effects of isothiocyanates and other glucosinolate derivatives on phase II enzyme activity (2, 36). Greater intake of cruciferous vegetables with a higher isothiocyanate content was associated with lower postmenopausal breast cancer risk. In addition, we found that the GSTP1 Val/Valgenotype was associated with a greater breast cancer risk, and premenopausal breast cancer risk was attenuated among women with a high cruciferous vegetable intake. This may suggest that a genetic predisposition to breast cancer related to GSTP1 genotype could be modified by cruciferous vegetable intake.

Read full Original Study for References

Another “China Study” defines best dietary practices for minimizing and reversing the incidence of major chronic disease

Watch documentary films about natural health diets as natural cancer cure.

Total Health Naturopathy for personal consulting and guidance for all health conditions